Human Variation And Race

High altitudes have a critical effect on the human body and also modify one’s endurance. At high altitudes the level of oxygen is approximately similar to that at sea level, however in high elevations the air pressure is lower causing the oxygen molecules to expand making it harder to breathe. It is harder to breathe because since the molecules cover a greater amount of area at high altitudes each time you breathe in you inhale less oxygen. With low air pressure in high altitudes there can be strains on the human body. The lower atmospheric pressure can cause a decrease in the oxygen pressure in the human body. The effects of that can cause potentially serious illness, which may sometimes lead to have a fatal consequence. Such illnesses can be high altitude sickness, high altitude pulmonary edema, and high altitude cerebral edema.

Short-term adaptation

A short-term adaption to high altitude is an increase in breathing and heart rate. In order to obtain more oxygen in our body our hearts have to pump harder. High altitudes can be very stressful for those with weak hearts. Also since the high altitude can cause moisture from our lungs and skin to evaporate quickly, it is very important to drink plenty of water to replenish and maintain your body’s homeostasis. 

Facultative adaptation

A facultative adaptation to high altitude would be an increase in the body’s red blood cell count. At a high altitude a persons red blood cells increase in order to carry more oxygen throughout the body. The lungs also increase to expand their capacity to transfer oxygen and other gases properly.

Developmental adaptation

Populations have developed adaptation in their DNA due to high altitudes. Throughout the years natural selection has resulted in some populations being more genetically suited for the pressures of living in high elevations. Many indigenous cultures living in the mountain valleys of Bolivia and Peru have adapted to the high altitude in a physiological manner. They produce more hemoglobin in their blood making them capable of breathing faster and carrying more oxygen to the rest of their body. However those who live in Tibet and Nepal, both countries that are located in high elevations, do not produce more hemoglobin. They tend to breathe faster causing them to have broader capillaries and arteries and allowing them to have higher rates of blood flow therefore their bodies would receive greater amounts of oxygen regardless of the fact that they do not produce more hemoglobin. 

Cultural adaptation

Individuals use tools and diet to help them adapt to higher altitudes. Like previously mentioned, higher elevations cause a great amount of water to be taken from our skin and lungs so by adapting our diet to consist in drinking plenty of water to replenish our water levels is one type of cultural adaptation. Another is the use of oxygen tanks with masks to make breathing easier for those who climb to high altitudes as a leisure pursuit.

It is beneficial to study human variation in higher altitudes across environmental clines. Studies have shown that those living in higher elevations tend to have a longer life. Also due to the fact that your heart is working extra, which is an added beneficial exercise, individuals can decrease the risk of heart disease in half. It is beneficial for athletes as well. By exercising at higher altitudes your body works harder which helps strengthen the heart and improve the body’s endurance.

A way to use race to understand the variation of the adaptations of higher altitude would be to look and the indigenous population of the Incas living in the high mountain valleys of Peru. Due to the increase of blood flow near the skin’s surface, their cheeks tend to be rosier. It also may seem that marathoners from Africa seem to be much more capable of winning than those from different countries. This is not solely due to their race but rather than that of where they live. Most countries in Africa, particularly Kenya, are located high above sea level resulting in greater athletic endurance.

LANGUAGE Blog

 My husband and I did this assignment together. First, I was to use no symbolic language. I found this to be difficult. I have been programmed to use body language along with spoken language. He had a hard time figuring out what I was talking about in our conversation with one another. It’s even hard to stick to the assignment because of laughter outbursts, because of the awkwardness of the whole situation. We had to make up a system of communication not previously know to us. This was fun, but we still hit walls and he didn’t have a good idea of what I was trying to say to him. Communication without symbolic language is difficult. Had we been two different cultures meeting for the first time, I would think that he would have the ultimate advantage of communicating complex ideas. I would only imagine that the symbolic culture would look down and have a sense of power over the “lesser” culture whom only uses body language along with grunts.  I myself see this everyday in our culture. Hispanic people have a slight language barrier with English speaking individuals and I see the harsh treatment, and the rude things people say about them. It’s a misfortunate clash of cultures that really limits our growth as humans to grow beyond the language and culture barriers we encounter day to day.

 Once again I found the use of just speech and no body language hard, because of the fact that I have been influenced by body, facial, hand, and head language since my birth. You can smile which shows lack of emotion. So now I have become emotionless and dull. What’s the point of speech without passion? My monotone communication has been a boring process for my husband and his attention was soon lost. He felt disconnected with me and I felt like a boring person. I think speech can’t lack any element in its execution otherwise there will be “a failure to communicate!” There are indeed people who cannot read body language: the blind. Yes there is a huge communication barrier. They cannot see the tone they are trying to set. Irritation, urgency, exaggeration, and many more emotions are set forth through body and physical gestures. I found both experiments equally hard, frustrating, and some what useless in the attempt to properly communicate with one another.

Piltdown Hoax Blog Post

1. Begin by giving a brief synopsis of the Piltdown hoax, including when and where it was found, by whom, and varying affects this had on the scientific community. Also include how the hoax was discovered and the varying responses it received from the scientist(s) involved and in the related fields of human evolution. (5 pts)

The fossils of the Piltdown man were discovered in a village in East Sussex, named Piltdown. An amateur archeologist Charles Dawson and his group of workers and 2 archeologist, claimed to found a piece of an ancient human skull in 1912. Throughout history, significant human fossils were never uncovered in England, until the trio came across what they thought to be the missing link between apes and humans, known as the pilt down man. Not long after, there were fossils found in Asia and Africa that caused scientists to question the validity of the Piltdown man.  In roughly 1949 scientist discovered a new method of dating or finding out how old fossils are by measuring the fluorine content. After that, the Piltdown Hoax was unraveled.  The teeth were even filed down in order to resemble human-like structure. The jaw bone dated back less than a hundred years and it was a female Orangutan. Now known to forger hundreds of other archeological discoveries; as far as motive and evidence it was Martin Hinton.  This was an amazing discovery and it amazes me how Martin Hinton got away from it for so long; it took over seventy years of evolution to find out the Piltdown man was a Hoax.  Due to this discovery scientist were appalled and were destined to not let this hoax, or anything even vaguely smelling of a hoax, happen again. It has caused scientists to be much more detailed and specific in their findings. When in doubt, keep doubting until something can be proven true.

2. Scientists are curious, creative and persistent by nature, but being human, they also have faults. What human faults come into play here in this scenario and how did these faults negatively impact the scientific process? (5 pts)

It took almost 40 years to prove the fraud. The scientists of the time that the bone was discovered did not have the right equipment to verify the authenticity of the fossil. They assumed that it was the missing link, and jumped to quick conclusions, as humans often do. The ego’s and greed of humans were apparent. The inventions in technology after world war one included the fluorine test.  The staining on the fossil was superficial, which is surprising that scientists didn’t discover this before. I thought that it would be obvious that the teeth had been manipulated, however it fooled even trained professionals. It negatively impacted the scientific process because it proved how easily people could be fooled, as well as how quickly ‘scientific proof’ could be overturned.

3. What positive aspects of the scientific process were responsible for revealing the skull to be a fraud? Be specific about scientific tools, processes or methodologies that were involved in providing accurate information about the Piltdown skull. (5 pts)

Because of the fluorine test that they invented around 1949, they found out it was an Orangutan that dated back less then 100 years ago; not ancient at all. The bones were also determined to have chromic acid stains and iron solution alterations to make them look older. After further analysis it was also proven that the teeth had been filed down, as well as pieces of the jaw bone broken off to resemble that of a human.

4. Is it possible to remove the “human” factor from science to reduce the chance of errors like this happening again? Would you want to remove the human factor from science? (10 pts)

I doubt it’s really probable to take the human factor out of the research. Science answers questions, and humans are the ones that develop these questions. Who would be pursuing science if not for humans? And how would humans remove their faults from their existence? Those can argue perfection and absolute truth, but most of us humans know that such a thing is something to strive for, but is not quite attainable. Rather than removing the human factor from science, maybe encourage the evolution of science to counter the human factor. When in doubt, keep doubting until you can prove beyond the shadow of a doubt that something is true. And even then, there is a possibility it will be proven wrong later. Such is the beauty, and fault, of science.

5. Life Lesson: What lesson can you take from this historical event regarding taking information at face value from unverified sources? (5 pts)

Never take anything as face value when dealing with science. Or even life in general. It is always good to over analyze, as opposed to under-analyze. Even in my life, I am taking my time with schooling, because I don’t want to rush through and realize once I get all of my degrees, that I chose the wrong profession. Take your time and be sure about things, look before you

Comparative Primate

A: Environment:

Lemurs live in a tropical paradise home spending most of their time in the trees. They can only be found in Madagascar and other neighboring Comoro islands living in the tops of trees and live in groups amongst the rainforest canopy. Their environment is a moist tropical lowland rainforest or in the rainforest mountains.  Some lemurs live in a dry bush land desert area located in the southern parts of Madagascar. Lemurs can also be found in farmlands due to their habitat loss from people clearing parts of the rainforest for cropping sugar and other resources.

 Spider monkeys can be found in tropical forests from southern Mexico to Brazil. They require large patches of undisturbed forests and specialize on nourishing ripe fruits within the forest. Their environment in which they live in enables them to move speedily though trees. Spider monkeys are threatened by people there habitat is destroyed by the continued agriculture and residential development.

Baboons can be found in parts of Africa. They live up in the trees and climb down when hunting for food. They can be found in open woodlands, grassland, savannas or some live in the rocky hillside county.

Gibbon is small class of primate monkeys. They spend almost most of their times living in trees. These animals are also endangered due to their destruction of their homelands. They are a territorial type of ape that live in the upper canopy of the lowland rainforest of South East Asia. Gibbons feed on insects leaves and fruits and flowers that there environment provides for them.

Chimpanzees can be found in the forests of Central and West Africa.  They habituate themselves to African low land rain forests, woodlands, and grasslands, in mountainside forests, and the savannah. The chimpanzee lives both in the trees and on land. They are a brilliant type of monkey that uses their resources from there environment as tools to use for food and other necessities.

B: Locomotor patterns:

Lemurs are quadruple type of primates that walk on all fours limbs. They are also well-known leapers that leap from tree branch to tree branch and from the ground onto trees. lemurs are Fairley well climbers due to their environment which consist many of trees. 

Spider monkeys live in trees and are very acrobatic monkeys they move from tree to tree with speed and can also hang on their tails. A spider monkeys locomotion is that different compared to others they are a quadruple type of monkey that uses suspensory locomotion 

Baboons teeth do not look anything like that of ordinary monkeys It is said that the shape of their teeth have been changed to look the way they do because of their genes environment. Baboons also walk on all four limbs they can be seen moving around on their heels and toes.

Gibbon: It is said that when gibbons swing, their wrist will naturally dislocate until the gibbon finishes its swing. They also have long hands and feet, they swing from tree to tree with their hands hanging on the trees like a hook type motion. Gibbons have a type of locomotion movement called biaxial movement. The gibbon’s ball-and-socket joints allow them great speed and accuracy when swinging moving through trees. Although gibbons spend most of their times in trees they are rarely are seen on the ground, when they are on the ground they are able to walk on two legs.

Chimpanzees normally walk on all fours limbs and walk on their front arms using their knuckles, and they can stand and walk upright. By swinging from branch to branch chimpanzees can move quite efficiently in the trees. Chimpanzees also have a firm grip and are also capable of holding objects with their hands. Because chimpanzees have such a firm grip they are capable of swinging from tree to tree with there arms.

C:

 Lemurs: lemurs were originally the type of monkey that lived the entire world but became extinct in all parts of the world because of other predators. Because Madagascar is a branch of Africa and separated from it thousands of years ago lemurs are now the only thing living there and have no known predators there. These animals adapt to all environments but only live in Madagascar a place full of trees makes them able to leap from branch to branch.

Spider monkeys are the type of monkey that become easy prey for many animals when they are on the ground so they are rarely seen on the ground so these animals learned to adapt to their environment consisting mainly high up in trees they became more flexible and are able to move swiftly through trees. Gibbons are very like spider monkeys they are very acrobatic and flexible due to their environment which consist mainly of trees. Because these two animals become easy prey for other animals when they are seen on the ground these monkeys spend most of their times in trees Therefore, making them adaptable to the trees around them. So these two types of monkeys are able to move swiftly through the forest tree branches.

Baboons are very different from other types of monkey they don’t swing from tree branch to tree branch mainly because of their environment, baboons don live in rainforest like other monkeys so they are not the swinging type. Baboons walk in a heel to toe type of motion due to them spending most of their time in trees.

Chimpanzees are adaptable to all types of environments. These types of monkeys are extremely brilliant they have a large size brain like that of a human. Why these monkey have developed a type of brain similar to humans is questionable it could mean that they are evolving and are the furthest type of monkey that has evolved. There locomotion pattern changes to the type of environment they live in. they are capable of swinging from tree to tree and there brain learns to develop into their environment.

C.    

Each and every one of these types of monkeys has been influenced by they’re environments. If you were to compare each and every type of monkey you will find similar types of traits. It’s a matter of where these monkeys were placed these monkey learned to adapt to their environment (like humans adapt to their environment when were placed in the dessert, mountains etc.) thus changing their genes and physical features to look different from each other. So the locomotion patterns these monkeys can be compared for example the locomotion types of the spider monkey and the gibbon are similar due to that fact that they spend most of their times in trees. Not only has environment which consist of trees for most of these monkeys become a factor of influence in the changing of locomotion patters but also natural predators that prey on sorts of monkeys has influenced there locomotion patters some monkey use their trees to their advantage to flee predators.

                                                                   

SPIDER MONKEY

BABOON

Chimpanzee

Gibbon

Lemurs

Homologus and Analogus traits

Homologus

The bat, a human, a mole, a tree screw, a wolf, a sea lion, and an elephant all evolved from a common ancestor,and they share common anatomical traits.As we can see in these  comparisons the forelimbs of the bat, a human, a mole, a tree screw, a wolf, a sea lion, and an elephant, the limbs look different on the outside and though they vary in function, they are very similar in skeletal structure. More significantly, they are from the same structures when in the embryo. Structures that are embryologically similar, but have different functions, are called homologous structures. Though these animals look different, a comparison of homologous structures indicates that they are similar.  In fact This suggests that these animals evolved from a common ancestor.

Analogous

For analogous traits I chose to use the example of a human eye and an octopus eye. Both humans and octopuses evolved what is referred to as camera eyes. Its called camera eye because it consists of a lens projecting an image onto a retina. The common ancestor of the octopus and of man possessed this analogous trait and adapted it so it could see.

Protein Synthesis :Blog post

TACTTTTGCTAAGGCAACGCAACTGAACGTAACGTAAAATCTATC







WISH YOU THE BEST IN DECODING!

Charles Lyell

1.I believe Charles Lyell was the most influential on the development of natural selection because he is the founder of modern geology.
2. Charles Lyell contributed a lot to the scientific community, by implementing the geological processes with a theory called geological uniformatism demonstrated that forces such as wind, erosion, local flooding all contributed in the past to produce the geological landscape that we see today.
Here is a link http://allaboutscience.org/sir-charles-lyell-faq.htm
3. I believe the bullet point that best describes Darwin’s point was the one that stated if the environment changes,the traits that are helpful or adaptive to that environment will be different.Here, Lyell demonstrated that forces such as wind ,water erosion, local flooding,frost ,decomposition of vegetable matter ,volcanoes, earthquakes,and glacial movements had all contributed in the past t o produce the geological landscape that we see today.


4.I believe that Darwin could not have developed his theory of natural selection without the influence of Lyell . This is because Darwin and Lyell shared a support of uniformitarian’s. Also it helped Darwin to validate his own beliefs . The processes were ongoing , indicating that geological change continues to still happen and the forces driving such change were consistent , or uniform , overtime.This means that various aspects of the earth’s surface such as the climate , plants, animals,and land surfaces vary through time, are constant.


5..Charles Darwin began slowing down on the process of publishing his book “On the origin of species” due to the fact that he was hesitated by the church because Darwin knew it would be very controversial with many people who believe in a literal interpretation of the bible would accept no compromise. Religion and science vary from different aspects of the human experience, and they aren’t inherently mutually exclusive approaches. Darwin was also troubled by his wife Emma, whom saw his ideas as running counter to her strong religious convictions.